Translate this page into:
Development of amplification refractory mutation system polymerase chain reaction-based assay for genotyping the single nucleotide polymorphisms of MED12 gene: An economical approach for case–control investigations of uterine leiomyoma
-
Received: ,
Accepted: ,
How to cite this article: Tiwari S, Pandey V, Patel Y, Gupta R, Rai P, Rani A, et al. Development of amplification refractory mutation system polymerase chain reaction-based assay for genotyping the single nucleotide polymorphisms of MED12 gene: An economical approach for case–control investigations of uterine leiomyoma. J Reprod Healthc Med. 2025;6:14. doi: 10.25259/JRHM_4_2025
Abstract
Uterine leiomyomas (UL), commonly known as fibroids, are non-cancerous tumors that develop in the uterine myometrium within the female reproductive system. Investigating single nucleotide polymorphisms, particularly mutations, is vital in understanding cancer and other diseases, assisting in genotypic classification, and guiding treatment and genetic counseling. This study aimed to develop and optimize the detection of the MED12 gene (rs199469672) G/A polymorphism in patients with ULs. A total of 160 participants were included in the study, where the tetra-primer amplification refractory mutation system polymerase chain reaction (ARMS-PCR) method was used to assess allele and genotype frequencies. The distribution of genotypes for the MED12 gene (rs199469672) G/A polymorphism was as follows: Homozygous GG at 37.7%, heterozygous GA at 56.3%, and homozygous AA at 6.2%. The allele frequencies were 65.6% for G and 34.4% for A. The genotype distribution conformed to Hardy–Weinberg equilibrium, with a P-value of 0.18. In conclusion, the somatic mutation (rs199469672) in MED12 appears to be tissue-specific, likely occurring in certain cell subsets within specific tissues. The absence of this mutation in blood samples reinforces the idea that it is a somatic event, possibly associated with localized conditions such as tumors or tissue-specific diseases. To further explore this mutation and its potential role in disease, additional studies are necessary, including larger and more varied tissue samples, as well as advanced techniques for isolating and detecting somatic mutations in blood, such as circulating tumor deoxyribo nucleic acid (DNA). This study demonstrates a straightforward, fast, and cost-efficient ARMS-PCR method for detecting allele-specific DNA polymorphisms and mutations.
Keywords
MED12 gene
Polymorphism
Tetra amplification refractory mutation system polymerase chain reaction
Uterine leiomyoma
INTRODUCTION
Uterine leiomyomas (ULs), also known as fibroids or myomas, are benign tumors composed of smooth muscle tissue that originates from the uterine myometrium. They represent the most frequently diagnosed tumors in gynecology worldwide. As women near menopause, lifestyle factors and the consumption of contaminated foods could heighten the likelihood of developing these tumors, frequently leading to infertility without an obvious cause. Numerous studies have highlighted the importance of diet and nutrition in influencing various gynecological disorders, including uterine fibroids.[1]
It is estimated that between 15% and 30% of women in their reproductive years have ULs, with this percentage increasing to 70–80% by the time they reach 50.[2,3] In India, findings from the 2015 to 2016 National Family Health Survey-4 indicate that the prevalence of ULs (30–70%) is closely associated with various demographic, geographic, and ethnic factors. These variations suggest a complex and multifaceted origin of the condition, with the potential for even greater prevalence if root causes remain unaddressed.[4] Shekhar et al.[5] reported that about 6% of Indian women of reproductive age undergo hysterectomy, most commonly due to heavy menstrual bleeding or pain (56%) and the presence of fibroids or cysts (20%). Further research confirms that symptomatic fibroids are a leading reason for hysterectomy among women aged 30–49.[5-7] According to Prusty et al.,[8] approximately 0.2–6.3% of women between the ages of 15 and 49 have undergone hysterectomy in 21 of the 36 Indian states and Union territories. This trend suggests that India is emerging as a significant region for the occurrence of ULs, with an increasing number of hysterectomies among women of reproductive age. Studies indicate that a significant percentage – approximately 70–80% – of uterine fibroids contain particular somatic mutations in the MED12 gene, a trend seen in different populations such as Caucasians from Finland, individuals in the northern United States, and South Africans.[9-11] This evidence highlights the necessity for genetic data that are specific to populations or ethnicities to enhance our comprehension of the fundamental mechanisms of the disease. The MED12 gene, a component of the mediator complex composed of 26 transcription-regulating subunits, facilitates the interaction between DNA regulatory regions and ribo nucleic acid (RNA) polymerase II, thereby playing a vital role in the control of gene transcription.[12] Studies have identified frequent heterozygous missense and frameshift mutations in exons 1 and 2 of the MED12 gene, marking them as common genetic alterations associated with fibroid formation.[13] In addition, somatic mutations such as rs199469672 have been detected specifically in exon 2; however, the frequency and impact of MED12 mutations on fibroid development among the North Indian population remain largely unexamined.
In this study, we introduced a novel approach using Amplification Refractory Mutation System Polymerase Chain Reaction (ARMS-PCR) to screen for a somatic mutation (rs199469672) in MED12 codon 131 G>A in blood samples.
MATERIAL AND METHODS
Sample collection and DNA extraction
As part of a pilot case–control study, blood samples were randomly collected from 160 individuals between December 2022 and December 2023. The samples were obtained from the Department of Obstetrics and Gynecology at the Institute of Medical Sciences, Banaras Hindu University, and Opal Hospital, Varanasi. The study received ethical clearance from the Institutional Ethical Review Committee (Ref: I.Sc./ECM-XV/2022–23). Written informed consent was obtained from all participants before sample collection. Genomic DNA was extracted from collected blood samples using the conventional salt precipitation technique and stored at −20°C until further processing. DNA concentration and purity were evaluated using a NanoDrop2000c spectrophotometer (Thermo Fisher Scientific) by measuring absorbance ratios at 260 nm and 280 nm (A260/A280).
Inclusion criteria
UL patients
The study included women aged 18–50 who had been diagnosed with ULs through ultrasound imaging. All gynecological ultrasound examinations were carried out by an experienced ultrasonographer using two-dimensional gray-scale imaging, which was performed either transabdominally or transvaginally.
Controls
The control group consisted of women aged 18–50 who did not report symptoms of bleeding or pelvic pain and had normal ultrasound findings. These women had no personal or family history of ULs.
Exclusion criteria
Women with ULs that could not be clearly identified, or those in whom adenomyosis was suspected, were excluded from the study.
Primer designing and ARMS-PCR
The ARMS-PCR reaction was carried out using an Applied Biosystems thermocycler (ABI). Each reaction mixture had a total volume of 25 μL, which included 12.5 μL of 2× master mix Green (EmraldAmp GT PCR Master Mix, Cat no. RR310A, Takara, Japan), 2 μL of genomic DNA (100–200 ng), 1 μL of each primer (10 pmol), and remaining of PCR-grade water. The PCR procedure began with an initial denaturation at 95°C for 5 min, followed by 40 cycles consisting of denaturation at 95°C for 5 min, annealing at 60°C for 40 s, and extension at 72°C for 45 s. The final extension step lasted for 45 sec at 72°C. For amplifying a 131 G>A region within the MED12 gene, a common reverse primer (R=TGTCCCTATAAGTCTTCCCAACCCAGGG) and two single nucleotide polymorphism (SNP)-specific forward primers (F1=CCTGCCCTTTCACCTTGTTCCTTCTTTT and F2=AACTGACGGCCTTGAATGTAAAACACGG) were utilized in two distinct PCR reaction mixtures. After amplification, PCR products were verified by running them on a 2% agarose gel, with a 1 kB DNA ladder (Gene Direx: Cat. No. DM010-R500) as a size marker, in 1× tris/ Ethylenediamine tetraacetic acid/Tris-acetate-EDTA/TAE buffer.
Statistical analysis
Statistical analysis was conducted to determine genotype and allele frequencies in compliance with Hardy–Weinberg equilibrium (HWE), through MEDCALC online tools (https://www.medcalc.org/calc/) to evaluate the χ2 test. The association between the MED12 (rs199469672) polymorphism and UL was assessed. A P < 0.05 was considered statistically significant.
RESULTS
Clinical characteristics of participants
Table 1 outlines the clinical features of both the UL and control groups. There were no significant differences in age or demographic characteristics between the two groups. The control group had no history of UL, either personally or within their family. In addition, their lifestyle factors, including living environment and dietary patterns, were also examined.
| Characteristics | Cases (n=80) | Control (n=80) | Significance level (P-value) |
|---|---|---|---|
| Age (years) | |||
| Mean±SD | 30.86±2.9 | 30.75±2.16 | No significant difference |
| BMI (kg/m2) | |||
| Mean±SD | 20.4±1.5 | 19.3±3.0 | P<0.01 |
| Living status | |||
| Rural | 60 | 50 | No significant difference |
| Urban | 20 | 30 | |
| Eating habit | |||
| Veg | 71 | 56 | No significant difference |
| Non veg | 9 | 24 | |
| Menstrual status | |||
| Premenopausal | 64 | 70 | No significant difference |
| Postmenopausal | 16 | 10 | |
| Leiomyoma size | |||
| >4 cm | 14 | NA | No significant difference |
| <4 cm | 66 | NA | |
BMI: Basal metabolic index, NA: Not applicable, SD: Standard deviation
The distribution of genotypes and allele frequencies for the MED12 variant
Utilizing the ARMS-PCR assay previously discussed, a band size of 293 bp is designated as the standard marker for genotyping the 131 G>A variant in the MED12 gene. We identified all three genotypes among our sampled individuals, which included both control groups and those with UL. For homozygous conditions, we successfully amplified either the GG or AA genotypes, while in the case of heterozygous conditions, we observed PCR amplification for both the G and A genotypes in distinct allele-specific reactions [Figure 1].

- Agarose gel showing that sample 1 is homozygous mutant (one band with 171 bp) and samples 2, 3, 4, and 5 were heterozygous (two bands; 293 bp and 171 bp) for MED12 gene in the case of uterine fibroid. bp: Base pair.
The UL patients and controls’ genotype and allele frequency distribution are summarized in Table 1. Specifically, the genotypic distribution of GA/AA versus GG and allele frequencies were examined. In both groups, the frequencies of genotypes showed a significant deviation from hardy-weinberg equilibrium (P = 0.02). The results related to the genetic variations of the (rs199469672) polymorphism were obtained through allele-specific ARMS-PCR, which utilized three primers for each sample. No significant differences in allele frequencies or genotype distributions were observed between the UL patients and the control group. Although the odds ratio for disease risk associated with the T allele was lower compared to the G allele (odds ratio = 0.7, 95% confidence interval: 0.45–1.17), this variation was not statistically significant (P = 0.18) [Table 2].
| Genetic composition | Control (n=80) | Case (n=80) | OR | P-value |
|---|---|---|---|---|
| Genotypes | ||||
| GG | 38 (47.5%) | 30 (37.7%) | 1 | |
| GA | 40 (50%) | 45 (56.3%) | 1.4 (0.7–2.7) | 0.27 |
| AA | 2 (2.5%) | 5 (6.2%) | 3.1 (0.6–17.4) | 0.19 |
| Alleles | ||||
| G | 116 (72.5%) | 105 (65.6%) | 1 | |
| A | 44 (27.5%) | 55 (34.4%) | 1.38 (0.88–2.2) | 0.184 |
OR: Odds ratio
DISCUSSION
ULs, which are the most common non-cancerous tumors composed of smooth muscle in the uterus, affect a large number of women. Research suggests that around 70% of people with UL possess certain mutations in the MED12 gene, a crucial component in the mediator complex that is vital for the formation of these tumors. Specifically, mutations in exon-2 of the MED12 gene appear to alter the function of the MED12 protein, either by enhancing or reducing its activity. In our previous research, we identified the Med12c.131G>A mutation as a key pathogenic variation in tissue samples from North India, which was confirmed using sequencing techniques.
Genome-wide association studies (GWAS) are commonly used to explore the genetic basis of complex diseases. However, the findings from GWAS need to be confirmed across various ethnic populations using advanced genotyping methods for single nucleotide polymorphism (SNP) analysis. The identified SNPs are typically analyzed using established techniques such as Dot blot, Denaturing gradient gel electrophoresis (DGGE), Restriction fragment length polymorphism (RFLP), and TaqMan assay, among others.[14] RFLP was the original method used to identify SNPs before PCR was developed. Nonetheless, RFLP has various drawbacks, including the expensive nature of restriction enzymes and the fact that the process is both time-consuming and labor-intensive. In addition, incomplete digestion of the amplified product in RFLP could lead to inaccurate genotyping results. In contrast, ARMS-PCR has become the preferred genotyping technique due to its simplicity and cost-effectiveness.[15] An allele-specific PCR method relies on the concept that DNA polymerase will only extend primers if the 3' end matches the target sequence.[16] In our research using the ARMS-PCR method, we successfully identified all three potential genotypes for this variant (rs199469672) Med12c.131G>A in the MED12 gene among leiomyoma individuals. ARMS-PCR has been shown to be an economical and quick genotyping technique, particularly for identifying UL-related SNPs in low-income nations. The accessibility and use of such SNP screening methods will play a crucial role in the future for forecasting or addressing complex diseases in developing countries.
In our analysis of 80 blood samples, the polymorphism was not detected. However, it was found in 12 out of 25 tissue samples through sequencing. This suggests that the polymorphism might be more prevalent or easier to detect in tissue samples compared to blood, possibly due to tissue-specific gene expression or other biological factors that influence its presence. Further research focusing on tissue types, sample processing methods, or the genetic context in which this polymorphism occurs could offer additional insights into the observed differences.[17] In fact, mutations in exon-2 appear to lead to alterations in the function of the MED12 protein, either enhancing or diminishing its activity. Our previous laboratory study indicated that Med12c.131G>A as a hotspot pathogenic mutation found in North Indian tissue samples through sequencing analysis.[18]
We did not find any MED12 gene polymorphism in 160 screened blood samples indicates that MED12 polymorphism could be tissue specific. However, it was identified in 12 out of 25 tissue samples through sequencing. This suggests that the polymorphism might be more prevalent or easier to detect in tissue samples compared to blood samples, potentially due to tissue-specific expression or other biological factors influencing its presence. Further investigation into the tissue types, the methods of sample processing, or even the specific genetic context in which this polymorphism is found could provide more insights into the observed discrepancy.
CONCLUSION
The somatic mutation (rs199469672) in the MED12 gene appears to be tissue-specific, likely occurring in a subset of cells within certain tissues. The absence of the mutation in blood samples supports the idea that this is a somatic event, possibly associated with a localized condition such as a tumor or other tissue-specific disease. Further studies involving larger and more diverse tissue samples, as well as methods to isolate and identify somatic mutations in blood (such as circulating tumor DNA), would be necessary to better understand the full scope of this mutation and its potential implications in disease.
Acknowledgments:
This study was financially supported by the Indian Council of Medical Research grant (ID File No: 33/12/2023/RD/BMS (eOffice No. 165369). This study was also supported by the Faculty Incentive and Bridge grant of IOE-BHU.
Ethical approval:
The research/study was approved by Institutional Ethical Committee of Institute of Science, Banaras Hindu University, number I.Sc./ECM-XV/2022–23, dated 24th November, 2022.
Declaration of patient consent:
The authors certify that they have obtained all appropriate patient consent.
Conflicts of interest:
There are no conflicts of interest.
Use of artificial intelligence (AI)-assisted technology for manuscript preparation:
The authors confirm that they have used artificial intelligence (AI)-assisted technology for assisting in the writing or editing of the manuscript or image creations.
Financial support and sponsorship: Nil.
References
- An audit of indications, complications, and justification of hysterectomies at a teaching hospital in India. Int J Reprod Med. 2014;2014:279273.
- [CrossRef] [PubMed] [Google Scholar]
- Epidemiology of uterine fibroids: A systematic review. BJOG. 2017;124:1501-12.
- [CrossRef] [PubMed] [Google Scholar]
- Uterine fibroids and diet. Int J Environ Res Public Health. 2021;18:1066.
- [CrossRef] [PubMed] [Google Scholar]
- Prevalence, sociodemographic determinants and self-reported reasons for hysterectomy in India. Rep Health. 2019;16:118.
- [CrossRef] [PubMed] [Google Scholar]
- MED12 mutations in uterine fibroids--their relationship to cytogenetic subgroups. Int J Cancer. 2012;131:152836.
- [CrossRef] [PubMed] [Google Scholar]
- Epidemiology of hysterectomy-a cross sectional study among Piligrims of Tirumala. IOSR J Dent Med Sci. 2015;14:1-5.
- [Google Scholar]
- Predictors of hysterectomy among married women 15-49 years in India. Reprod Health. 2018;15:3.
- [CrossRef] [PubMed] [Google Scholar]
- Whole exome sequencing in a random sample of North American women with leiomyomas identifies MED12 mutations in majority of uterine leiomyomas. PLoS One. 2012;7:e33251.
- [CrossRef] [PubMed] [Google Scholar]
- The route of hysterectomy: A comparative study between abdominal hysterectomy (AH), non-descent vaginal hysterectomy (NDVH), and laparoscopic assisted vaginal hysterectomy (LAVH) Int J Rep Cont Obs Gyn. 2018;7:4022-8.
- [CrossRef] [Google Scholar]
- MED12, the mediator complex subunit 12 gene, is mutated at high frequency in uterine leiomyomas. Science. 2011;334:252-5.
- [CrossRef] [PubMed] [Google Scholar]
- The human mediator complex: A versatile, genome-wide regulator of transcription. Trends Biochem Sci. 2010;35:315-22.
- [CrossRef] [PubMed] [Google Scholar]
- MED12 gain-of-function mutation causes leiomyomas and genomic instability. J Clin Invest. 2015;125:3280-4.
- [CrossRef] [PubMed] [Google Scholar]
- SNPs in disease gene mapping, medicinal drug development and evolution. J Human Genet. 2007;52:871-80.
- [CrossRef] [PubMed] [Google Scholar]
- Medium-throughput SNP genotyping using mass spectrometry: Multiplex SNP genotyping using the iPLEX® Gold assay. Methods Mol Biol. 2011;700:61-76.
- [CrossRef] [PubMed] [Google Scholar]
- Optimized allele-specific real-time PCR assays for the detection of common mutations in KRAS and BRAF. J Mol Diagn. 2011;13:23-8.
- [CrossRef] [PubMed] [Google Scholar]
- Gene variants polymorphisms and uterine leiomyoma: An updated review. Front Genet. 2024;15:1330807.
- [CrossRef] [PubMed] [Google Scholar]
- Variants in exon 2 of MED12 gene causes uterine leiomyoma's through over-expression of MMP-9 of ECM pathway. Mutat Res. 2024;828:111839.
- [CrossRef] [PubMed] [Google Scholar]


